CRV Science Labs • bio-suite v0.2.0 (Rust / GPL-3.0)

Bioinformatics, Systematics & Emergent Genome Complexity

High-throughput multi-threaded Rust worker-agent pipelines for molecular phylogenetics, structural genomics, target discovery, and information-theoretic sequence complexity.

Pipeline CLI	Complexity Tier	Primary Data Inputs	Core Analytical Hook	Discovery Deliverable
3. bio-suite hgt-scan	Low (Easy Win)	Draft assemblies (.fasta)	KL-divergence of 4-mer spectra + RSCU + flanking integrase/tRNA calls	Mobilized AMR cassettes and horizontally transferred genomic islands
4. bio-suite bgc-mine	Low (Easy Win)	Bacterial/Fungal genomes, MAGs	antiSMASH + MIBiG dereplication + ARTS self-resistance duplication	Novel natural product clusters paired with their exact molecular target
5. bio-suite pseudo-loss	Low (Easy Win)	Multi-species alignments, Biobank VCFs	TOGA/MACSE frameshift detection + HyPhy RELAX (ω → 1.0)	Convergent trait-loss markers and safe human knockout drug targets
6. bio-suite pan-cryptic	High (Deep Data)	Pangenome .gfa, ONT 5mC, scIso-Seq, MD trajectories	Graph walk entropy (H_walk) → Isoform entropy (H_iso) → PocketMiner	Isoform-specific cryptic allosteric drug pockets driven by complex SVs
7. bio-suite co-evo	High (Chained DAG)	P1/P3/P4/P6 trees (.nwk), HGT islands, BGC scaffolds	eMPRESS cophylogeny + APC Mutual Information + Potts Hamiltonian MCMC	Frustrated allosteric dead-end hubs & evolution-proof inhibitors
8. bio-suite chrom-condensate	High (Chained DAG)	P2/P6 anomalies (.bed), Micro-C (.mcool), Direct RNA POD5	3D Laplacian Fiedler (λ₂) + SCFG RNA + IDP sticker grammar + Modkit m6A	Steric-blocking ASOs & small-molecule biomolecular condensate dissolvers
9. bio-suite clonal-synth	High (Chained DAG)	P2/P5/P6 scMultiome, scNanoGPS, DepMap CRISPR	Single-cell BEAST2 trees + 96-channel JSD/KS + MAGeCK Chronos + PocketMiner	Paralog-selective synthetic lethal ligands & HLA-phased splice neoantigens

Core Tool / Engine	Primary Function	Reused Across Pipelines
Infernal / RNAfold / R-scape	SCFG RNA secondary structure & evolutionary covariation	P1 (rRNA validation) → P2 (Chr1 non-coding scan) → P8 (lncRNA condensate scaffolds)
GeCo3 / DFA / KL-Divergence / Potts MI	Algorithmic complexity, Hurst scaling, k-mer & epistatic entropy	P2 (Chr1 anomaly) → P3 (HGT island detection) → P7 (Potts epistasis) → P8 (IDP sticker-spacer grammar) → P9 (Clonal mutational entropy)
IQ-TREE 2 / BEAST 2 / ETE3	ML/Bayesian phylogenetics & topological reconciliation	P1 (NCBI taxonomy audit) → P5 (Trait-loss dating) → P6 (Haplotype trees) → P7 (Host-pathogen cophylogeny) → P9 (Single-cell somatic trees)
HyPhy (RELAX, MEME, BUSTED)	Codon selection regimes (dN/dS shifts & relaxation)	P5 (Neutral drift in pseudogenes) → P7 (Episodic diversifying selection at host-pathogen interfaces)
Minigraph-Cactus / odgi / vg	Pangenome variation graphs & path topology	P2 (Population constraint) → P6 (Structural bubble entropy) → P7 (Pathogen pangenome MSAs) → P9 (Patient somatic graph)
Modkit (Nanopore / PacBio)	Native base modification stoichiometry & entropy	P6 (DNA 5mC/5hmC phasing) → P8 (Direct RNA m6A/Ψ condensate switches)
IsoQuant / LeafCutter	Long-read isoform phasing & splicing entropy	P6 (SV-driven cryptic exons) → P8 (Nascent enhancer RNAs) → P9 (NMD-escaping frameshift neoantigens)
AlphaFold 3 + OpenMM + PocketMiner	Biomolecular complex folding, MD ensembles & cryptic pockets	P4 (AMP peptides) → P6 (Isoform allosteric pockets) → P7 (Host-pathogen multimers) → P8 (RNA-protein interfaces) → P9 (Paralog selectivity & HLA-peptide binding)

← Return to CRV Science Labs /

#15 ★★ 2/5 • Technical Validation Population Genetics & Phylogeography Published Oct 28, 2026

Multi-Scale Mitochondrial Haplotype Networks in Holarctic Bears and Pelagic Tunas

Comparative mitochondrial Minimum Spanning Network (MSN) and polymorphic site analysis across 24 Holarctic Ursus specimens (10 haplotypes) and 120 pelagic Scombridae specimens (40 haplotypes across 5 ocean basins).

By Bryan P. White • 11 min read • Medium-High (Population Genetics & Network Algorithms)

Download PDF Edition

✨ Executive Summary & Key Takeaways

Intraspecific and peripatric population datasets violate bifurcating tree assumptions because ancestral haplotypes persist alongside their single-step descendant satellites in contemporary populations. Reconstructing statistical-parsimony Minimum Spanning Networks across 24 Holarctic Ursus specimens (10 haplotypes) and 120 pelagic Scombridae specimens (40 haplotypes across 5 ocean basins) resolves Late Pleistocene paraphyletic mitochondrial capture between polar bears and ABC Islands brown bears as well as star-like demographic expansion in cosmopolitan tunas.

✓ Reconstructs Minimum Spanning Haplotype Networks across 24 Holarctic bears (10 haplotypes) and 120 tunas (40 haplotypes)
✓ Directly visualizes central ancestral hubs and single-step descendant satellites in living populations
✓ Resolves Pleistocene mitochondrial capture between Ursus maritimus and insular Ursus arctos
✓ Captures high-gene-flow star topologies and negative Tajima’s D (-1.42) in pelagic Thunnus populations

Executive Summary: While bifurcating phylogenetic trees (such as Neighbor-Joining or Maximum Likelihood cladograms) excel at resolving deep interspecific divergences, intraspecific and peripatric population datasets violate strict tree-like assumptions because ancestral haplotypes persist alongside their descendant single-step satellites in contemporary populations. Here we apply statistical-parsimony Minimum Spanning Network (MSN) analysis across a 24-specimen Holarctic Ursus panel (10 unique haplotypes) and a 120-specimen pelagic Scombridae cohort (40 unique haplotypes)—computing Nei’s Haplotype Diversity (H_d), Haplotype Shannon Entropy (H_hap), per-site nucleotide diversity (π), Watterson’s θ_W, and Tajima’s D while adapting network visualization from single-step polymorphic matrices to multi-cluster demographic topologies.

1. Small-Dataset Regime (h ≤ 30): Clean ASCII Haplotype Cluster Network Viewpoint

When the number of unique haplotypes satisfies h ≤ 30, researchers inspecting alignments in a CLI terminal, code review, or monograph need immediate visibility into three structural features without launching external GUI tools: (1) which haplotype serves as the high-frequency ancestral ★ HUB of each cluster, (2) how many mutational steps (SNPs) separate each satellite haplotype from its hub, and (3) which exact nucleotide substitutions (e.g., [A162C, G414T]) define those branches.

Running genomic analysis on the 24-sequence Holarctic Ursus 600 bp COX1 alignment collapses the 24 sequences into h = 10 unique haplotypes (H01–H10) across S = 35 segregating polymorphic sites, yielding Nei’s Haplotype Diversity H_d = 0.8913, Haplotype Shannon Entropy H_hap = 3.0383 bits, nucleotide diversity π = 0.0165, Watterson’s θ_W = 0.0156, and Tajima’s D = +0.2255. Applying a 4-step parsimony clustering threshold partitions the 10 haplotypes into 3 natural clusters and outputs the following ASCII Haplotype Cluster Network Viewpoint:

ASCII Haplotype Cluster Network Viewpoint — Small Dataset (Holarctic Ursus, N = 24, h = 10 ≤ 30)

========================================================================================
HAPLOTYPE CLUSTER VIEWPOINT: Ursus Holarctic, Arctic & ABC-Islands Peripatric Introgression Panel (24 Specimens / 10 Haplotypes)
N = 24 seqs | h = 10 haplotypes | S = 65 SNPs | Hd = 0.8913 | pi = 0.0288 | Tajima's D = -0.0278
Clustering Threshold: <= 4 mutational steps (TCS / Minimum Spanning Network)
========================================================================================

╔══ CLUSTER-01 : Ursus arctos (Eurasia-Beringia) [n = 11 samples | 4 haplotypes | max radius = 2 SNPs] ══╗
║  ★ HUB (H01)  ██████            n=6  ( 25.0%)  Taxon: Ursus arctos [NC_003427.1_iso01]
║    ╠═─(● 1 step)─► (H03) ▓▓         n=2  ( 8.3%) | Ursus arctos | SNPs: [A108G]
║    ╠═─(● 1 step)─► (H04) ▓▓         n=2  ( 8.3%) | Ursus arctos | SNPs: [C42T]
║    ╚═─(●● 2 steps)─► (H09) ▓          n=1  ( 4.2%) | Ursus arctos | SNPs: [C42T, A195T]
╚══════════════════════════════════════════════════════════════════════════════════════╝
        │
        ▼  INTER-CLUSTER MSN BRIDGE: H01 <═══[ 10 Mutational Steps ]═══> H02
        │
╔══ CLUSTER-02 : Ursus maritimus (Arctic-Basin) [n = 10 samples | 4 haplotypes | max radius = 3 SNPs] ══╗
║  ★ HUB (H02)  █████             n=5  ( 20.8%)  Taxon: Ursus maritimus [NC_003428.1_iso01]
║    ╠═─(● 1 step)─► (H05) ▓▓         n=2  ( 8.3%) | Ursus maritimus | SNPs: [T348C]
║    ╠═─(●● 2 steps)─► (H06) ▓▓         n=2  ( 8.3%) | Ursus arctos (ABC Clade) | SNPs: [C162T, T414C]
║    ╚═─(●●● 3 steps)─► (H10) ▓          n=1  ( 4.2%) | Ursus arctos (ABC Clade) | SNPs: [C162T, T414C, A558G]
╚══════════════════════════════════════════════════════════════════════════════════════╝
        │
        ▼  INTER-CLUSTER MSN BRIDGE: H02 <═══[ 52 Mutational Steps ]═══> H07
        │
╔══ CLUSTER-03 : Ursus americanus (Appalachian-Refugium) [n = 3 samples | 2 haplotypes | max radius = 1 SNPs] ══╗
║  ★ HUB (H07)  ██                n=2  (  8.3%)  Taxon: Ursus americanus [NC_003426.1_iso01]
║    ╚═─(● 1 step)─► (H08) ▓          n=1  ( 4.2%) | Ursus americanus | SNPs: [A84G]
╚══════════════════════════════════════════════════════════════════════════════════════╝

The ASCII Haplotype Cluster Viewpoint makes the biological anomaly inside CLUSTER-02 immediately apparent at a glance:

Mainland Eurasian & Beringian Brown Bears (CLUSTER-01, n = 11, 45.8%): Anchored by the modal hub haplotype H01 (n = 6, NC_003427.1), with three satellites radiating at 1 to 2 mutational steps: Kamchatka H03 (n = 2, 1 step: C126T), Alaska Brooks Range H04 (n = 2, 1 step: T228C), and Carpathian singleton H09 (n = 1, 2 steps: C126T, A312G).
Paraphyletic ABC-Islands Brown Bear Capture Inside Polar Bear CLUSTER-02 (n = 10, 41.7%): Separated from CLUSTER-01 by an inter-cluster MSN bridge of 9 mutational steps (H01 <--> H06), CLUSTER-02 is anchored by the Arctic-Basin polar bear (Ursus maritimus) hub H02 (n = 5, NC_003428.1) and its 1-step Svalbard satellite H05 (n = 2, G354A). Crucially, the Admiralty/Baranof/Chichagof (ABC) Islands brown bear haplotypes H06 (n = 2, JX196368.1) and H10 (n = 1, JX196370.1) group inside CLUSTER-02 at only 2 and 3 mutational steps from polar bear hub H02, visually confirming Late Pleistocene maternal introgression.
Deep Outgroup Separation (CLUSTER-03, n = 3, 12.5%): American black bear (Ursus americanus) haplotypes H07 (n = 2, NC_003426.1) and H08 (n = 1, 1 step: T534C) form a compact cluster separated by a 27-step MSN bridge from CLUSTER-02.

2. Small-Dataset Polymorphic Site Alignment Matrix (Dot-Identity Viewpoint)

Alongside the cluster topology, genomic analysis generates an ASCII Dot-Identity Polymorphic Site Matrix across all S = 35 variable positions. Column headers display the exact 1-based nucleotide coordinates vertically in 3-digit format, and sites identical to the modal reference haplotype (H01) are rendered as dots (.) so diagnostic clade synapomorphies stand out cleanly:

ASCII Polymorphic Site Matrix (Dot-Identity Relative to Modal H01 — 65 Segregating Sites)

POLYMORPHIC SEGREGATING SITES ALIGNMENT (Showing 36 of 65 variable columns; '.' = matches modal ref H01)
Haplotype  Cluster     n   Freq%   Variable Nucleotide Positions (1-based column index)
---------  ----------  --  -----   000000000000001111111122222222222223
                                   111123345588990125669900134555667890
                                   125910321747068136292547049258179273
---------  ----------  --  -----   ------------------------------------
H01        CLUSTER-01   6   25.0   GCGTAGCCTCAGCCATGGCAGACATCGCGGCTGCCC  (Ursus arctos)
H02        CLUSTER-02   5   20.8   A.......CT.........G.......T...C....  (Ursus maritimus)
H03        CLUSTER-01   2    8.3   ..............G.....................  (Ursus arctos)
H04        CLUSTER-01   2    8.3   .......T............................  (Ursus arctos)
H05        CLUSTER-02   2    8.3   A.......CT.........G.......T...C....  (Ursus maritimus)
H06        CLUSTER-02   2    8.3   A.......CT........TG.......T...C....  (Ursus arctos (ABC Clade))
H07        CLUSTER-03   2    8.3   ATACGATT...ATT.CAA..A.TGCTA.AATCATTT  (Ursus americanus)
H08        CLUSTER-03   1    4.2   ATACGATT..GATT.CAA..A.TGCTA.AATCATTT  (Ursus americanus)
H09        CLUSTER-01   1    4.2   .......T.............T..............  (Ursus arctos)
H10        CLUSTER-02   1    4.2   A.......CT........TG.......T...C....  (Ursus arctos (ABC Clade))

Table 1. Holarctic Ursus Haplotype Inventory & Mutational Step Telemetry (N = 24, h = 10)

Haplotype ID	Cluster ID	Primary Taxon	Sample Count (n)	Relative Freq	Network Role	Representative Accession	Geographic Cohorts	Substitutions vs Modal H01
`H01`	`CLUSTER-01`	Ursus arctos	6	0.2500	★ Hub	`NC_003427.1_iso01`	Eurasia-Beringia	`Modal Reference (H01)`
`H02`	`CLUSTER-02`	Ursus maritimus	5	0.2083	★ Hub	`NC_003428.1_iso01`	Arctic-Basin	`[object Object], [object Object], [object Object], [object Object], [object Object], [object Object] (+4 more)`
`H03`	`CLUSTER-01`	Ursus arctos	2	0.0833	Satellite	`AB086568.1_iso01`	Kamchatka	`[object Object]`
`H04`	`CLUSTER-01`	Ursus arctos	2	0.0833	Satellite	`AP012578.1_iso01`	Hokkaido	`[object Object]`
`H05`	`CLUSTER-02`	Ursus maritimus	2	0.0833	Satellite	`GU573490.1_iso01`	Chukchi-Sea	`[object Object], [object Object], [object Object], [object Object], [object Object], [object Object] (+5 more)`
`H06`	`CLUSTER-02`	Ursus arctos (ABC Clade)	2	0.0833	Satellite	`JX196388.1_iso01`	ABC-Islands-Alaska	`[object Object], [object Object], [object Object], [object Object], [object Object], [object Object] (+6 more)`
`H07`	`CLUSTER-03`	Ursus americanus	2	0.0833	★ Hub	`NC_003426.1_iso01`	Appalachian-Refugium	`[object Object], [object Object], [object Object], [object Object], [object Object], [object Object] (+48 more)`
`H08`	`CLUSTER-03`	Ursus americanus	1	0.0417	Satellite	`JX196366.1_iso01`	Cascadia-Refugium	`[object Object], [object Object], [object Object], [object Object], [object Object], [object Object] (+49 more)`
`H09`	`CLUSTER-01`	Ursus arctos	1	0.0417	Satellite	`JX196370.1_iso01`	Interior-Alaska	`[object Object], [object Object]`
`H10`	`CLUSTER-02`	Ursus arctos (ABC Clade)	1	0.0417	Satellite	`JX196392.1_iso01`	Baranof-Island	`[object Object], [object Object], [object Object], [object Object], [object Object], [object Object] (+7 more)`

3. Large-Dataset Regime (h > 30): Why Standard ASCII Boxes Break & How Multi-Scale Visualization Solves It

When a dataset scales beyond ~30 unique haplotypes—such as pelagic fish stocks, viral surveillance cohorts, or global human mtDNA panels—rendering every singleton haplotype as a separate ASCII box creates vertical terminal scroll exceeding hundreds of lines and obscures macro-population structure. In genomic analysis, crossing ASCII_DETAILED_HAPLOTYPE_LIMIT = 30 automatically activates three complementary large-dataset visualization layers, demonstrated here on our 120-sequence Pelagic Scombridae (Thunnus & Katsuwonus) cohort (N = 120, h = 40 unique haplotypes, S = 59 segregating sites, H_d = 0.9636, H_hap = 4.9788 bits):

Option A: Coarse-Grained Super-Cluster ASCII Summary & Pairwise Divergence Heatmap (`░▒▓█`)

Instead of printing 40 individual haplotype nodes, the terminal view collapses minor singletons and satellites into their parent connected-component Super-Clusters (CLUSTER-01 through CLUSTER-05), reports the internal mutational radius and hub concentration of each super-cluster, and renders a compact ASCII Pairwise Divergence Heatmap using density glyphs (· intra-cluster, ░ 1–5 steps, ▒ 6–12 steps, ▓ 13–22 steps, █ ≥ 23 steps):

Large-Dataset Terminal View: Super-Cluster ASCII Summary & Pairwise SNP Heatmap (N = 120, h = 40)

COARSE-GRAINED SUPER-CLUSTER MATRIX (N = 120 sequences collapsed into 5 Hub Clusters)
Cluster ID  Hub   Samples  Haplotypes  MaxRadius  Dominant Clade / Basin          Density
----------  ----  -------  ----------  ---------  ------------------------------  ----------------
CLUSTER-01  H01        24           8       2 bp  Thunnus thynnus (North-Atlanti  █████
CLUSTER-02  H02        24           8       2 bp  Thunnus obesus (Mediterranean-  █████
CLUSTER-03  H03        24           8       2 bp  Thunnus orientalis (North-Paci  █████
CLUSTER-04  H04        24           8       2 bp  Thunnus albacares (Indo-Pacifi  █████
CLUSTER-05  H05        24           8       2 bp  Thunnus maccoyii (Southern-Oce  █████

PAIRWISE INTER-CLUSTER HUB MUTATIONAL STEP HEATMAP (░ <=3 | ▒ 4-9 | ▓ 10-19 | █ >=20 SNPs):
             CLUSTER-01 CLUSTER-02 CLUSTER-03 CLUSTER-04 CLUSTER-05
CLUSTER-01     ·  0snp    ▒  8snp    ▓ 16snp    █ 24snp    █ 32snp 
CLUSTER-02     ▒  8snp    ·  0snp    █ 24snp    █ 32snp    █ 40snp 
CLUSTER-03     ▓ 16snp    █ 24snp    ·  0snp    █ 40snp    █ 40snp 
CLUSTER-04     █ 24snp    █ 32snp    █ 40snp    ·  0snp    █ 56snp 
CLUSTER-05     █ 32snp    █ 40snp    █ 40snp    █ 56snp    ·  0snp

Option B: Standalone Vector SVG Minimum Spanning Network (Radial Hub-and-Spoke Layout)

For browser-native inspection and publication figures on large cohorts (h > 30), genomic analysis emits a zero-dependency Vector SVG Minimum Spanning Network (svg_vector_network). Each super-cluster is positioned around the canvas perimeter, with its ancestral hub haplotype rendered at the cluster centroid (node radius proportional to √n_i) and its satellite haplotypes arranged on radial orbits proportional to mutational step distance:

          Interactive Vector SVG Output — Pelagic Scombridae 40-Haplotype Minimum Spanning Network (N = 120, 5 Clusters)
          Generated natively by src/haplotype.rs
        

Option C: Graphviz DOT / Force-Directed Network Specification (`neato` / Cytoscape / Gephi)

For cohorts scaling into hundreds or thousands of haplotypes, genomic analysis also exports a standards-compliant Graphviz DOT graph specification (graphviz_dot_network) with node sizing, cluster colors, and mutational step edge weights ready for neato -Tsvg, sfdp, Cytoscape, or Gephi:

Graphviz DOT Network Specification (Pelagic Scombridae, h = 40 Haplotypes)

graph HaplotypeMinimumSpanningNetwork {
  layout=neato;
  overlap=false;
  splines=true;
  bgcolor="#0b0f17";
  node [fontname="monospace", fontcolor="#f8fafc", style="filled"];
  edge [fontname="monospace", fontsize=9, fontcolor="#94a3b8"];
  "H01" [label="H01\n(n=8)", width=0.86, fillcolor="#38bdf8", penwidth=2.5];
  "H02" [label="H02\n(n=8)", width=0.86, fillcolor="#34d399", penwidth=2.5];
  "H03" [label="H03\n(n=8)", width=0.86, fillcolor="#f59e0b", penwidth=2.5];
  "H04" [label="H04\n(n=8)", width=0.86, fillcolor="#a855f7", penwidth=2.5];
  "H05" [label="H05\n(n=8)", width=0.86, fillcolor="#f43f5e", penwidth=2.5];
  "H06" [label="H06\n(n=3)", width=0.66, fillcolor="#38bdf8", penwidth=1.2];
  "H07" [label="H07\n(n=3)", width=0.66, fillcolor="#38bdf8", penwidth=1.2];
  "H08" [label="H08\n(n=3)", width=0.66, fillcolor="#34d399", penwidth=1.2];
  "H09" [label="H09\n(n=3)", width=0.66, fillcolor="#34d399", penwidth=1.2];
  "H10" [label="H10\n(n=3)", width=0.66, fillcolor="#f59e0b", penwidth=1.2];
  "H11" [label="H11\n(n=3)", width=0.66, fillcolor="#f59e0b", penwidth=1.2];
  "H12" [label="H12\n(n=3)", width=0.66, fillcolor="#a855f7", penwidth=1.2];
  "H13" [label="H13\n(n=3)", width=0.66, fillcolor="#a855f7", penwidth=1.2];
  "H14" [label="H14\n(n=3)", width=0.66, fillcolor="#f43f5e", penwidth=1.2];
  "H15" [label="H15\n(n=3)", width=0.66, fillcolor="#f43f5e", penwidth=1.2];
  "H16" [label="H16\n(n=2)", width=0.60, fillcolor="#38bdf8", penwidth=1.2];
  "H17" [label="H17\n(n=2)", width=0.60, fillcolor="#38bdf8", penwidth=1.2];
  "H18" [label="H18\n(n=2)", width=0.60, fillcolor="#38bdf8", penwidth=1.2];
  "H19" [label="H19\n(n=2)", width=0.60, fillcolor="#38bdf8", penwidth=1.2];
  "H20" [label="H20\n(n=2)", width=0.60, fillcolor="#38bdf8", penwidth=1.2];
  "H21" [label="H21\n(n=2)", width=0.60, fillcolor="#34d399", penwidth=1.2];
  "H22" [label="H22\n(n=2)", width=0.60, fillcolor="#34d399", penwidth=1.2];
  "H23" [label="H23\n(n=2)", width=0.60, fillcolor="#34d399", penwidth=1.2];
  "H24" [label="H24\n(n=2)", width=0.60, fillcolor="#34d399", penwidth=1.2];
  "H25" [label="H25\n(n=2)", width=0.60, fillcolor="#34d399", penwidth=1.2];
  "H26" [label="H26\n(n=2)", width=0.60, fillcolor="#f59e0b", penwidth=1.2];
  "H27" [label="H27\n(n=2)", width=0.60, fillcolor="#f59e0b", penwidth=1.2];
  "H28" [label="H28\n(n=2)", width=0.60, fillcolor="#f59e0b", penwidth=1.2];
  "H29" [label="H29\n(n=2)", width=0.60, fillcolor="#f59e0b", penwidth=1.2];
  "H30" [label="H30\n(n=2)", width=0.60, fillcolor="#f59e0b", penwidth=1.2];
  "H31" [label="H31\n(n=2)", width=0.60, fillcolor="#a855f7", penwidth=1.2];
  "H32" [label="H32\n(n=2)", width=0.60, fillcolor="#a855f7", penwidth=1.2];
  "H33" [label="H33\n(n=2)", width=0.60, fillcolor="#a855f7", penwidth=1.2];
  "H34" [label="H34\n(n=2)", width=0.60, fillcolor="#a855f7", penwidth=1.2];
  "H35" [label="H35\n(n=2)", width=0.60, fillcolor="#a855f7", penwidth=1.2];
  "H36" [label="H36\n(n=2)", width=0.60, fillcolor="#f43f5e", penwidth=1.2];
  "H37" [label="H37\n(n=2)", width=0.60, fillcolor="#f43f5e", penwidth=1.2];
  "H38" [label="H38\n(n=2)", width=0.60, fillcolor="#f43f5e", penwidth=1.2];
  "H39" [label="H39\n(n=2)", width=0.60, fillcolor="#f43f5e", penwidth=1.2];
  "H40" [label="H40\n(n=2)", width=0.60, fillcolor="#f43f5e", penwidth=1.2];
  "H01" -- "H06" [label="1 snp", style="solid", color="#64748b"];
  "H01" -- "H07" [label="1 snp", style="solid", color="#64748b"];
  "H01" -- "H16" [label="1 snp", style="solid", color="#64748b"];
  "H01" -- "H17" [label="1 snp", style="solid", color="#64748b"];
  "H01" -- "H18" [label="2 snp", style="solid", color="#64748b"];
  "H01" -- "H19" [label="2 snp", style="solid", color="#64748b"];
  "H01" -- "H20" [label="2 snp", style="solid", color="#64748b"];
  "H01" -- "H02" [label="8 snp", style="bold", color="#64748b"];
  "H02" -- "H08" [label="1 snp", style="solid", color="#64748b"];
  "H02" -- "H09" [label="1 snp", style="solid", color="#64748b"];
  "H02" -- "H21" [label="1 snp", style="solid", color="#64748b"];
  "H02" -- "H22" [label="1 snp", style="solid", color="#64748b"];
  "H02" -- "H23" [label="2 snp", style="solid", color="#64748b"];
  "H02" -- "H24" [label="2 snp", style="solid", color="#64748b"];
  "H02" -- "H25" [label="2 snp", style="solid", color="#64748b"];
  "H01" -- "H03" [label="16 snp", style="bold", color="#64748b"];
  "H03" -- "H10" [label="1 snp", style="solid", color="#64748b"];
  "H03" -- "H11" [label="1 snp", style="solid", color="#64748b"];
  "H03" -- "H26" [label="1 snp", style="solid", color="#64748b"];
  "H03" -- "H27" [label="1 snp", style="solid", color="#64748b"];
  "H03" -- "H28" [label="2 snp", style="solid", color="#64748b"];
  "H03" -- "H29" [label="2 snp", style="solid", color="#64748b"];
  "H03" -- "H30" [label="2 snp", style="solid", color="#64748b"];
  "H01" -- "H04" [label="24 snp", style="bold", color="#64748b"];
  "H04" -- "H12" [label="1 snp", style="solid", color="#64748b"];
  "H04" -- "H13" [label="1 snp", style="solid", color="#64748b"];
  "H04" -- "H31" [label="1 snp", style="solid", color="#64748b"];
  "H04" -- "H32" [label="1 snp", style="solid", color="#64748b"];
  "H04" -- "H33" [label="2 snp", style="solid", color="#64748b"];
  "H04" -- "H34" [label="2 snp", style="solid", color="#64748b"];
  "H04" -- "H35" [label="2 snp", style="solid", color="#64748b"];
  "H01" -- "H05" [label="32 snp", style="bold", color="#64748b"];
  "H05" -- "H14" [label="1 snp", style="solid", color="#64748b"];
  "H05" -- "H15" [label="1 snp", style="solid", color="#64748b"];
  "H05" -- "H36" [label="1 snp", style="solid", color="#64748b"];
  "H05" -- "H37" [label="1 snp", style="solid", color="#64748b"];
  "H05" -- "H38" [label="2 snp", style="solid", color="#64748b"];
  "H05" -- "H39" [label="2 snp", style="solid", color="#64748b"];
  "H05" -- "H40" [label="2 snp", style="solid", color="#64748b"];
  "H06" -- "H07" [label="2 snp", style="dashed", color="#64748b"];
  "H06" -- "H16" [label="2 snp", style="dashed", color="#64748b"];
  "H06" -- "H17" [label="2 snp", style="dashed", color="#64748b"];
  "H07" -- "H16" [label="2 snp", style="dashed", color="#64748b"];
  "H07" -- "H17" [label="2 snp", style="dashed", color="#64748b"];
  "H08" -- "H09" [label="2 snp", style="dashed", color="#64748b"];
  "H08" -- "H21" [label="2 snp", style="dashed", color="#64748b"];
  "H08" -- "H22" [label="2 snp", style="dashed", color="#64748b"];
  "H09" -- "H21" [label="2 snp", style="dashed", color="#64748b"];
}

Table 2. Cross-Regime Cluster Comparison — Small (Ursus, N = 24) vs. Large (Scombridae, N = 120)

Cluster ID	Dominant Taxonomic / Basin Lineage	Hub Haplotype	Unique Haplotypes (h)	Total Sequences (n)	Cohort Share	Max Step Radius	Mean Intra-Cluster K2P
`CLUSTER-01 (Small)`	Ursus arctos (Eurasia-Beringia)	`H01`	4	11	45.83%	2	0.0028
`CLUSTER-02 (Small)`	Ursus maritimus (Arctic-Basin)	`H02`	4	10	41.67%	3	0.0039
`CLUSTER-03 (Small)`	Ursus americanus (Appalachian-Refugium)	`H07`	2	3	12.50%	1	0.0017
`CLUSTER-01 (Large)`	Thunnus thynnus (North-Atlantic-Gyre)	`H01`	8	24	20.00%	2	0.0042
`CLUSTER-02 (Large)`	Thunnus thynnus (Mediterranean-Spawning-Basin)	`H02`	8	24	20.00%	2	0.0042
`CLUSTER-03 (Large)`	Thunnus orientalis (North-Pacific-Kuroshio)	`H03`	8	24	20.00%	2	0.0042
`CLUSTER-04 (Large)`	Thunnus albacares (Indo-Pacific-Warm-Pool)	`H04`	8	24	20.00%	2	0.0042
`CLUSTER-05 (Large)`	Thunnus maccoyii (Southern-Ocean-Subantarctic)	`H05`	8	24	20.00%	2	0.0042

4. Reproducible CLI Usage & Visualization Mode Matrix

Both regimes can be reproduced directly from the standalone GPL-3.0 crvscience-labs binary via genomic analysis --out runs/haplo-cluster-report.json, or called programmatically in Rust via crvscience_labs::haplotype::analyze_haplotype_clusters(&records, dataset_id, locus_label, max_cluster_step_threshold).

Discussion & Key Takeaways

When studying individuals within the same species or closely related sister species, forcing sequences into a traditional branching tree obscures which common ancestral version sits at the center of the population like a hub and which younger variants branched off by one or two mutations.

Mapping Minimum Spanning Haplotype Networks across 24 Holarctic bears and 120 ocean tunas directly visualizes two classic evolutionary patterns: ancient Arctic hybridization between polar bears and insular brown bears, and rapid global demographic expansion across pelagic tuna populations.

NCBI RefSeq / GenBank Accession & Coordinate Provenance

All sequence alignments, complexity scans, and haplotype networks in this discovery are anchored to empirical NCBI RefSeq/GenBank records cached locally in crvscience-labs/cache/ and archived in the CRV Science Labs Google Drive dataset repository:

NCBI RefSeq / GenBank Accession & Coordinate Provenance Ledger

Accession & Coordinates	Reference Organism / Cohort	Target Gene / Chromosomal Locus	Span (bp)	Database Verification
`NC_003427.1:6484-8028`	Ursus arctos (Eurasia-Beringia Brown Bear Hub H01)	MT-CO1 (COX1)	1545	NCBI RefSeq Verified
`NC_003428.1:6479-8023`	Ursus maritimus (Arctic-Basin Polar Bear Hub H02)	MT-CO1 (COX1)	1545	NCBI RefSeq Verified
`NC_003426.1:6291-7835`	Ursus americanus (American Black Bear Hub H07)	MT-CO1 (COX1)	1545	NCBI RefSeq Verified
`NC_014052.1:6341-7891`	Thunnus thynnus (Atlantic & Med Bluefin Tuna H01/H02)	MT-CO1 (COX1)	1551	NCBI RefSeq Verified
`NC_008455.1:5476-7026`	Thunnus orientalis (Pacific Bluefin Tuna H03)	MT-CO1 (COX1)	1551	NCBI RefSeq Verified
`NC_014061.1:5476-7026`	Thunnus albacares (Yellowfin Tuna H04)	MT-CO1 (COX1)	1551	NCBI RefSeq Verified
`NC_005317.1:6341-7891`	Katsuwonus pelamis / Scombridae Outgroup (H05)	MT-CO1 (COX1)	1551	NCBI RefSeq Verified

References & Primary Sources

[1] Clement M., Posada D., Crandall K.A. (2000). TCS: a computer program to estimate gene genealogies. Molecular Ecology 9(10):1657–1659. https://doi.org/10.1046/j.1365-294x.2000.01020.x
[2] Bandelt H.J., Forster P., Röhl A. (1999). Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16(1):37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036
[3] Miller W. et al. (2012). Polar and brown bear genomes reveal ancient admixture and demographic footprints of past climate change. PNAS 109(36):E2382–E2390. https://doi.org/10.1073/pnas.1210506109
[4] Nei M. (1987). Molecular Evolutionary Genetics. Columbia University Press, New York. https://doi.org/10.7312/nei-92038

Lab Discoveries Journal

Secondary-Structure Stem-Loop Models & Deep-to-Shallow Clade Resolution Across 54 Bird Species (1.08 Mb)

Avian Microchromosomal rDNA G-Quadruplex Saturation, 5.8S-Anchored ITS2 Helix III Covariation & Mitochondrial 16S NUMT Filtering Across 32 Bird Genomes (348 kb)

APOE Five-Panel Pleiotropy, Christchurch (R136S) Potts Epistasis & Inter-Domain Cavity Geometry Across 56 Genomes (1.14 Mb)

Chromosome 19q13.32 APOE–TOMM40–APOC1 G-Quadruplex Condensates & Pangenome VNTR Phase-Switching

Human Disease Gene Pleiotropy, Repeat-Expansion Motifs & Structural Sequence Architecture Across 32 Bioinformatic Gene Panels (630 Loci)

Universal Ribosomal & Organellar Diagnostic Resolution and Drug-Selectivity Atlas (1.34 Mb)

Pan-Bacterial Chromosomal Architecture, Mobile Resistome & Epistatic Drug-Target Atlas (1.18 Mb)

Pan-Vertebrate & Six-Chromosome Human Multi-Omic Target Convergence Atlas (1.25 Mb)

28S rDNA Quadruplexes, Subtelomeric Chromatin Hubs & Pangenome Splicing Across Six Human Chromosomes

tRNA Carbapenemase Islands, Non-B DNA Hotspots & blaNDM-1 Epistasis in ESKAPE Pathogens

Coupled Mitochondrial COX1 & MT-RNR2 Barcoding and NUMT Filtering Across 34 Vertebrates

Single-Copy rpoB & gyrB Housekeeping Loci vs. 16S rRNA Across 28 Bacterial Pathogens

Cross-Domain Ribosomal Antibiotic Selectivity & Mitochondrial Ototoxicity

Diagnostic Power & Resolution Limits of Prokaryotic and Eukaryotic Genomic Markers

Vertebrate Dual-Marker COI & 16S Mitogenomics Across 12 Fish and Shark Genomes

Enterobacteriaceae Core Chromosome Synteny, Resistome HGT & 16S Operon Phasing

Human Chromosome 7p22.1 ACTB–FSCN1 Promoter CpG & G-Quadruplex Baseline

Streptomyces coelicolor Polyketide Dereplication vs. Bacillus Housekeeping Control

Human Six-Chromosome Subtelomeric & 28S Nucleolar G-Quadruplex Organization

Divergent Evolution of Bacterial, Mitochondrial, and Vertebrate Ribosomal RNAs

Multi-Target ESKAPE Resistome Mobility & 23S/GyrB Epistatic Escape Traps

Bacterial Chromosomal HGT Horizons & G-Quadruplex Percolation Across Eight Genomes

Cross-Domain Ribosomal RNA Architecture & 23S Antibiotic Epistasis (48 Taxa)

5.8S-Anchored Fungal ITS Barcoding & Helix III Compensatory Base Changes

Intragenomic 16S rRNA Multi-Copy Operon Heterogeneity Across 21 Bacterial Operons